Characterization of Helicobacter pylori iceA and baba2 virulence genes in dyspeptic patients at a teaching hospital in Ghana

¹Department of Biomedical Sciences, School of Basic and Biomedical Sciences, University of Health and Allied Sciences, Ho, Ghana, ²Department of Medicine and Therapeutics, University of Ghana Medical School, Accra, Ghana, ³Department of Medical Laboratory Sciences, School of Biomedical and Allied Health Sciences, University of Ghana, Accra, Ghana, ⁴Department of Medical Laboratory Technology, Accra Technical University, Accra, Ghana, ⁵Division of Pathology, Military Hospital, Accra, Ghana

^&Corresponding author
Timothy Archampong, Department of Medicine and Therapeutics, University of Ghana Medical School, Accra, Ghana

Introduction    

Helicobacter pylori is a microaerophilic, gram-negative bacterium that thrives in the gastric epithelium of a number of vertebrates including humans [1]. Studies have shown that H. pylori infection is the most common chronic bacterial infection known to humans [2], with approximately, 50% of the world´s population is infected [2]. In Africa, Helicobacter pylori infection is endemic with prevalence high across all age groups studied [3]. It is known to be a major cause of peptic ulcers disease and one of the leading independent risk factors for distal gastric cancer. It is the first formally recognized bacterial carcinogen [2]. Additionally, it is also known to be linked to gastric mucosa-associated tissue lymphoma [4,5]. If not treated, the infection or colonization can last a lifetime [2]. However, only a small percentage (10-15%) of the world´s population is affected with H. pylori develop disease [6].

Although infection is universally associated with gastritis, the development of clinical and endoscopic disease is dependent on a number of factors, including the virulence of the infecting strain, the susceptibility of the host, and environmental co-factors [7]. A recent study demonstrated the influence of Helicobacter pylori virulence factors cagA and vacA on clinical and endoscopic disease in Accra, Ghana, an endemic sub-Saharan Africa country [8]. Most biopsies harboured H. pylori expressing both cagA and vacA virulent genes [8], but sparse information is available about the presence of iceA and babA2 genes in patients with dyspepsia in the region.

The objective of this study was to characterize other key virulence factors, H. pylori iceA and babA2 genes to ascertain their significance in dyspeptic Ghanaian patients.

Methods     

Study design: this research study received ethical approval from the University of Health and Allied Sciences Research Committee, Ho, Ghana. This study employed a cross-sectional design consecutively recruiting eligible participants. Patient sampling occurred during one endoscopy session per week (Friday mornings), from June - September 2019. Informed consent was obtained from all subjects who met the inclusion criteria by means of either a signature or thumbprint following which the study questionnaire was completed. Recruitment, data collection, and analysis occurred between June 2019 and April 2020.

Setting: the study setting was the Korle-Bu Teaching Hospital in Accra which has 2,500 beds and is the main tertiary referral centre in Accra serving the majority of the southern half of Ghana.

Participants: patients were eligible if they were medical inpatients or clinic out-patients attending the Endoscopy Unit, Korle Bu Teaching Hospital having been referred with upper gastrointestinal symptoms for endoscopy.

Variables: the study questionnaire gathered categorical data on patients´ demographics, bio-data, associated symptoms, lifestyle/dietary habits, signs and endoscopic diagnoses (gastritis, gastric ulcer, duodenal ulcer, gastric cancer). Categorical outcome variables included H. pylori status by urease-CLO test and iceA, babA positivity by PCR.

Measurements: all experiments were performed in accordance with relevant guidelines and regulations. Helicobacter status was defined by urease-CLO rapid urease testing on gastric antral biopsies performed at endoscopy. Following upper-gastro-intestinal endoscopy, three systematic gastric antral biopsies per patient were preserved in 0.5 ml DNA-gard solution (Biometrica In, San Deigo, USA).

Determination of Helicobacter pylori status with rapid urease testing: in the Endoscopy Unit, Korle-Bu Teaching Hospital, a gastric antral biopsy sample following upper gastrointestinal endoscopy was tested by the rapid urease CLO-test (Cambridge Life Sciences Ltd, Cambridge, UK) to determine the presence of Helicobacter pylori in samples.

Genomic DNA extraction: genomic DNA was extracted from stored tissue samples collected from patients using a QIAGEN DNA mini kit (Qiagen Co Ltd, USA). After extraction, genomic DNA was stored at -20° C until further analysis.

Molecular analysis of Helicobacter pylori virulence genes: gastric antral biopsies obtained by endoscopy were stored in specimen tubes containing DNA gard solution (Biomatrica, Inc, Oberlin Drive, San Diego, USA) which preserves DNA at room temperature.

Polymerase Chain Reaction (PCR) analysis of iceA gene: the primers described by Smith et al. [9], for iceA gene 1 and 2 were used in this work. PCR amplification was performed under the following conditions: 5X PCR buffer (New England, Biolab Inc), 1.0µl of each primer (for iceA1; 5' CATTGTATATCCTATCATTAC3' and 5' GTTGGGTAAGCGTTACAGAATTT 3') for iceA2, 5'GTTGGGTATATCACAATTTAT3'; 5' TTRCCCTATTTTCTAGTAGGT3'). Five µl of template DNA, and 0.125 µl Taq polymerase, 2 mM MgCl₂, 0.5 mM dNTPs (dATP, dTTP, dGTP, dCTP) in 25 µl of reaction. The amplification program included an initial denaturation cycle at 95°C for 2 min, 40 cycles at 94°C for 30s, 50°C for 30s, 72°C for 30s, and a final extension cycle at 72°C for 5 min. The product of amplification was 567 and 229/334 bp fragments of iceA gene 1 and 2, respectively. After the reaction 10µL of the PCR product was run by electrophoresis at 100 volt using 2% agarose gel (Biopioneer Co, USA) stained with 0-5 ug/mL ethidium bromide (Life Technologies Co, USA) in 1X Tris-acetate EDTA (TAE) running buffer (Biopioneer Co, USA) using 2 µl of blue/orange DNA loading dye (6X) (Promega Co, USA). A hundred nucleotide base pair molecular size marker (Sigma Mo, USA) was run alongside the PCR products on the gel. The gel was photographed using UV illumination (UVIsave gel documentation system, model GAS9200/1/2/3, version 12) and analyzed.

Polymerase Chain Reaction (PCR) analysis of babA2 gene: the primers described by Gerhard et al. [10] was used in this work. PCR amplification was performed under the following conditions: 5X PCR buffer (New England, Biolab Inc), 8.5 pmol of each primer (F5'AATCCAAAAAGGAGAAAAAACATGAAA-3' and R5' TGTTAGTGATTTCGGTGTAGGACA-3'), 5 µl of template DNA, and 0.5 U Taq polymerase, 1.5 mM MgCl₂, 0.2 mM dNTPs (dATP, dTTP, dGTP, dCTP) in 25 µl of reaction. The amplification program included an initial denaturation cycle at 95°C for 3 min, 40 cycles at 95°C for 30s, 57°C for 40s, 72°C for 45s, and a final extension cycle at 72°C for 5 min. The product of amplification was 850 bp fragment of the babA2 gene. After the reaction, 10 µl of the PCR product was run by electrophoresis at 120 volts using in 2% agarose gel (Biopioneer Co, USA) stained with 0-5 ug/ml ethidium bromide (Life Technologies Co, USA) in 1X Tris acetate EDTA (TAE) running buffer (Biopioneer Co, USA) using 2 µl of blue/orange DNA loading dye (6X) (Promega Co, USA). A hundred nucleotide base pair molecular size marker (Sigma Mo, USA) was run alongside the PCR products on the gel. The gel was photographed using UV illumination (UVIsave gel documentation system, model GAS9200/1/2/3, version 12) and analysed.

Bias: in order to address bias, patients with prior Helicobacter eradication treatment or proton-pump inhibitor use two weeks preceding endoscopic analysis were excluded as they were potential confounders and likely to reduce or modify H. pylori prevalence.

Study size: a total of 100 dyspeptic patients were recruited.

Statistical methods: data obtained from questionnaires were stored and analysed using Microsoft Excel software. To avoid missing data, data collection was done by trained research staff with follow-up contact details of participants included in the questionnaire. Percentages were used to analyse qualitative variables. Statistical significance was set at p < 0.05.

Results     

Participants: approximately eighty patients attended the Endoscopy Unit, KBTH for upper GI endoscopy on a weekly basis during the study period. Ten patients were examined each week for eligibility on Fridays (160 during the study sampling period), of whom 115 patients were confirmed eligible. The main reasons for non-participation in the study included recent antibiotic or proton-pump inhibitor use. Out of the 115 eligible patients, 100 consented and were recruited (Figure 1).

Descriptive data: the prevalence of H. pylori using the CLO-urease test in the study population was 71% of which 56.3% were male (n=40). The greater majority were in the age range of 31-40 representing 23% followed by the age group 41-50 with 20 participants (20%) (Table 1). Neither age, gender, smoking status, dietary preference, herbal preparation, alcohol intake, nor household composition was associated with H. pylori positivity (Table 2). Patients with all the endoscopic diagnoses (gastritis, gastric ulcer, duodenal ulcer, gastric cancer) had an increased prevalence of H. pylori (60.5 - 90.1%) in comparison with patients with normal endoscopy (Table 3).

Outcome data: in total, 46 CLO-positive samples were randomly analysed by PCR to characterize H. pylori iceA gene (Figure 2), of which, 12 (26%) and 7 (15%) were found to have iceA1 gene and iceA2 genotypes respectively. Figure 2 illustrates the 576 bp PCR amplicon obtained for the iceA1 gene following 2% gel electrophoresis. Of the CLO-positive samples, 9 were randomly selected and taken through PCR analysis for the babA2 gene (Table 4). Three samples were babA2 positive and 6 were babA2 negative.

Discussion     

In Ghana, there was a high prevalence of infection from H. pylori, 71.1%, as previously identified [8]. The pathogenesis of H. pylori is orchestrated by a myriad of virulence factors that facilitate colonization, inflammation, and host injury [11]. The cag pathogenicity island (cagPAI) and vacuolating cytotoxin A (vacA) are undoubtedly some of the most evaluated virulence factors of H. pylori [12]. The risk of peptic ulcer disease, pre-malignant gastric pathology (intestinal metaplasia and gastric atrophy) and ultimately distal gastric adenocarcinoma have a higher incidence in patients infected with cagA-positive strains when compared with persons infected with cagA-negative strains [13,14]. Furthermore, strains containing vacA alleles with s1, i1, or m1 sub-type have been demonstrated to have significantly elevated vacuolating activity than those with s2, i2, or m2 and are associated with an increased risk of peptic ulcer disease, pre-malignant lesions as well as gastric cancer [15,16]. A previous study in Ghana, showed that the majority of infected dyspeptic individuals at the tertiary centre harboured cagA and vacA virulent strains [8].

It is noteworthy that other virulence factors have been implicated in H. pylori disease pathogenesis [17]. Specifically, iceA has been reported by van Doorn LJ et al. [18] as significantly associated with peptic ulcer, with this relationship independent of the cagA and vacA status. IceA has two main allelic forms, iceA1 and iceA2 [17]. The expression of iceA1 has been shown to be upregulated when H. pylori adheres to human epithelial cells, with the iceA1 genotype associated with increased mucosal interleukin (IL)-8 expression and gastric inflammation [19,20]. However, the prevalence and clinical influence of iceA varies across populations [17]. The overall prevalence of iceA1 was significantly higher in Asian countries than in Western countries (64.6% vs. 42.1%), whereas the prevalence of iceA2 was more prevalent in Western countries than in Asian countries (45.1% vs. 25.8%) [17]. By contrast, iceA was clinically significant in Western populations and not Asian countries. Further correlation analysis showed differing relationships with the two isoforms of iceA, iceA1 being significantly associated with peptic ulcer but iceA2 rather inversely associated with peptic ulcer [17].

This study was designed to characterize H. pylori iceA genotypes in Ghana. Of the 46-CLO positive samples analyzed, 12 (26%) and 7 (15%) were found to have iceA1 and iceA2 genotypes respectively (Table 4). IceA prevalence in this study in Accra, Ghana was markedly lower than its prevalence in a previous study of 86 dyspeptic South African studies where iceA1 was detected in 68% and iceA2 in 80% of all clinical isolates [21]. Genetic analysis of iceA1 in the South African study demonstrated significant homology (92-95%) with the USA type strain 26695 [21], implying it is likely aligned to Western strains. Another study in Nigeria found iceA1 prevalence of 94.7% and 86.4% in isolates from duodenal ulcer and non-ulcer dyspepsia respectively [9]. In Ghana, although vacA and cagA are endemic, iceA prevalence is rather low and probably exerts a limited effect on bacterial virulence.

The H. pylori genome has several outer membrane proteins (OMP) related genes [13]. Most OMP-encoding genes are preserved in all H. pylori strains; however, some may be differentially present across isolates [13]. One of the most widely studied OMPs, babA adheres to the fucosylated Lewis b histoblood group antigen on host cells [22]. These adhesion proteins vary in prevalence globally. High prevalence regions include Eastern Asia where all express babA2 while low prevalence areas were Western and Southern Europe which had rates of 44.0% and 44.6% respectively [23]. Of the CLO-positive samples in this present study, 9 were randomly selected and taken through PCR analysis for the babA2 gene (Table 4). Three samples were babA2 positive and 6 were babA2 negative.

Limitations: babA2 had a low prevalence in this study but given the small number of samples, no further inferences can be made as it is unlikely to be generalizable to the larger population. This study being descriptive, did not provide a correlation between iceA and clinical phenotype or cagA/vacA status.

Conclusion     

In Ghana, although H. pylori is endemic, iceA prevalence is rather low and probably exerts a limited effect on bacterial virulence. Further evaluation would be required, not only to determine association with other virulence factors but more importantly, inter-relationships with wider host and environmental factors which can impact on disease pathogenesis.

Competing interests     

The authors declare no competing interests.

Authors' contributions     

Richard Harry Asmah and Timothy Archampong contributed to the conception and the study design; Gabriel King, Benjamin Eyison, and Andrew Kwablah Teye performed genetic analysis, supervised by Richard Harry Asmah and Timothy Archampong; Timothy Archampong, Richard Harry Asmah, Gabriel King, Christopher Adjei, and Gloria Amegatcher contributed to the initial manuscript draft; Ebenezer Krampah Aidoo and Seth Attoh provided review of analyses and contributed to manuscript development. All the authors read, reviewed, and approved the final version of this manuscript.

Tables and figures     

Table 1: age distribution of study participants

Table 2: risk factors for H. pylori among the study population

Table 3: endoscopic diagnoses and H. pylori status of study participants

Table 4: prevalence of iceA1, iceA2 and babA2 H. pylori virulence genes in dyspeptic patients

Figure 1: study recruitment flow diagram

Figure 2: amplicon size of 567 bp obtained from iceA1 gene PCR analysis (ethidium bromide-stained 2.0% agarose gel electrophoregram of amplified iceA1 DNA fragments (567 bp) with gene primers. Lane M is a 100 bp DNA ladder. Lane 4 and 7 PCR positives and lane 5 negative control)

References